Stem-loop sequence mes-MIR394a

AccessionMI0020966 (change log)
DescriptionManihot esculenta miR394a stem-loop
Gene family MIPF0000100; MIR394
Literature search

3 open access papers mention mes-MIR394a
(14 sentences)

Stem-loop
        u      a        uuu  u          -      u c           cauc   a  aa  -  uc 
5' ucaug ggguuu acaaaggg   cu acagaguuua uuggca u uguccaccucc    ugu ga  uc ug  u
   ||||| |||||| ||||||||   || |||||||||| |||||| | |||||||||||    ||| ||  || ||  c
3' agugc cucaaa uguuucuc   gg ugucucgagu aaccgu a acggguggagg    aca cu  ag ac  u
        u      a        ucu  u          c      c u           ---u   -  cg  c  uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold09683: 173393-173543 [+]
intergenic
Database links

Mature sequence mes-miR394a

Accession MIMAT0024417
Sequence

38 - 

uuggcauucuguccaccucc

 - 57

Get sequence
Evidence not experimental

References

1
"Overview of the potential of microRNAs and their target gene detection for cassava (Manihot esculenta) improvement" Amiteye S, Corral JM, Sharbel TF African J Biotech. 10:(2011).