Stem-loop sequence mes-MIR408

AccessionMI0020968 (change log)
DescriptionManihot esculenta miR408 stem-loop
Gene family MIPF0000102; MIR408
Literature search

4 open access papers mention mes-MIR408
(12 sentences)

Stem-loop
   g    uaa         c    ---a   acu     c      a          aa   uu    caa 
5'  aggg   agaaagaga ggac    aag   gggaa aggcag gcaugggugg  cua  aaca   g
    ||||   ||||||||| ||||    |||   ||||| |||||| ||||||||||  |||  ||||    
3'  uccc   ucuuuuucu ucug    uuc   cccuu uccguc cguacccacc  gau  uugu   u
   -    ucg         -    ggcg   ggu     c      a          ac   -u    cua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold00080: 302009-302142 [-]
intergenic
Database links

Mature sequence mes-miR408

Accession MIMAT0024419
Sequence

88 - 

augcacugccucuucccuggc

 - 108

Get sequence
Evidence not experimental

References

1
"Overview of the potential of microRNAs and their target gene detection for cassava (Manihot esculenta) improvement" Amiteye S, Corral JM, Sharbel TF African J Biotech. 10:(2011).