Stem-loop sequence hvu-MIR5049f

AccessionMI0021519 (change log)
DescriptionHordeum vulgare miR5049f stem-loop
Gene family MIPF0001200; MIR5067
Literature search

2 open access papers mention hvu-MIR5049f
(4 sentences)

Stem-loop
   ug      uucu      c        a          a    c     u       ua 
5'   aaaagu    acuccc ccgaucca auuaauugac cugc uuagu caacuuu  g
     ||||||    |||||| |||||||| |||||||||| |||| ||||| |||||||   
3'   uuuuca    ugaggg ggcuaggu uaauuaacug gacg aauca guugaaa  u
   ug      ----      a        a          c    c     u       ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hvu-miR5049f

Accession MIMAT0024829
Sequence

86 - 

aauuaauauggaucggaggga

 - 106

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22489137 "Identification and characterization of microRNAs from barley (Hordeum vulgare L.) by high-throughput sequencing" Lv S, Nie X, Wang L, Du X, Biradar SS, Jia X, Weining S Int J Mol Sci. 13:2973-2984(2012).