Stem-loop sequence hvu-MIR6213

AccessionMI0021531 (change log)
DescriptionHordeum vulgare miR6213 stem-loop
Literature search

2 open access papers mention hvu-MIR6213
(2 sentences)

Stem-loop
   ----------         u a  a     -----    g u    ---    gaaagacagaaacuuucugcuccggaaaagaauuuuuauuuuuuucuauaagagauuuugaguug 
5'           gauuagucu g gg ugauc     guuu g caug   cugg                                                                 a
             ||||||||| | || |||||     |||| | ||||   ||||                                                                 u
3'           cuggucaga c uc guuag     caaa c guau   gacc                                                                 u
   caauuaucgu         - a  -     acaua    g -    uga    augaaguuuuuaagacuuuuuaauacugucagacuucuuaaacacaucguuagacgucguuuuuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hvu-miR6213

Accession MIMAT0024841
Sequence

188 - 

acagauugcuacagacugguc

 - 208

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22489137 "Identification and characterization of microRNAs from barley (Hordeum vulgare L.) by high-throughput sequencing" Lv S, Nie X, Wang L, Du X, Biradar SS, Jia X, Weining S Int J Mol Sci. 13:2973-2984(2012).