Stem-loop sequence ppe-MIR482c

AccessionMI0021620 (change log)
DescriptionPrunus persica miR482c stem-loop
Gene family MIPF0000403; MIR482
Literature search

2 open access papers mention ppe-MIR482c
(6 sentences)

Stem-loop 
   --u     ua        ug a         -u        u     aaa    c      a 
5'    ggagc  cugggaau  u ggaaugggc  guuuggga gaaag   auca uaagaa a
      |||||  ||||||||  | |||||||||  |||||||| |||||   |||| ||||||  
3'    ccucg  gaucuuua  a ccuuacccg  cgaacccu cuuuu   uagu guucuu u
   ccu     gc        gu a         cc        u     --a    u      u
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Gao et al. identified small RNAs by sequencing in Prunus mume [1]. The reads were mapped to the Prunus persica genome. This entry represents the Prunus persica sequence, but the evidence for mature RNA expression is from Prunus mume.

Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG3: 16316472-16316592 [+]
intergenic
Database links

Mature sequence ppe-miR482c-5p

Accession MIMAT0027283
Sequence

21 -  

ggaaugggcuguuugggaug

 - 40

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence ppe-miR482c-3p

Accession MIMAT0031169
Sequence

80 -  

uucccaagcccgcccauuccaa

 - 101

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:22863067 "High-throughput sequencing of small RNAs and analysis of differentially expressed microRNAs associated with pistil development in Japanese apricot" Gao Z, Shi T, Luo X, Zhang Z, Zhuang W, Wang L BMC Genomics. 13:371(2012).
2
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).