![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ppe-MIR482c |
|||||
Accession | MI0021620 (change log) | ||||
Description | Prunus persica miR482c stem-loop | ||||
Gene family | MIPF0000403; MIR482 | ||||
Literature search |
2 open access papers mention ppe-MIR482c | ||||
Stem-loop |
--u ua ug a -u u aaa c a 5' ggagc cugggaau u ggaaugggc guuuggga gaaag auca uaagaa a ||||| |||||||| | ||||||||| |||||||| ||||| |||| |||||| 3' ccucg gaucuuua a ccuuacccg cgaacccu cuuuu uagu guucuu u ccu gc gu a cc u --a u u |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
Gao et al. identified small RNAs by sequencing in Prunus mume [1]. The reads were mapped to the Prunus persica genome. This entry represents the Prunus persica sequence, but the evidence for mature RNA expression is from Prunus mume. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence ppe-miR482c-5p |
|
Accession | MIMAT0027283 |
Sequence |
21 - ggaaugggcuguuugggaug - 40 |
Evidence | experimental; Illumina [1-2] |
Mature sequence ppe-miR482c-3p |
|
Accession | MIMAT0031169 |
Sequence |
80 - uucccaagcccgcccauuccaa - 101 |
Evidence | experimental; Illumina [2] |
References |
|
1 | |
2 |
PMID:22909020
"Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs"
BMC Plant Biol. 12:149(2012).
|