Stem-loop sequence ppe-MIR171a

Accession

MI0021623 (change log)

Description

Prunus persica miR171a stem-loop

Gene family

MIPF0000030; MIR171_1

Literature search

6 open access papers mention ppe-MIR171a
(16 sentences)

Stem-loop

   --aau   u    uua   g        uc         a         u    uaa 
5'      gga cggu   acg gauauugg  cgguucaau agaaagcag gcuc   g
        ||| ||||   ||| ||||||||  ||||||||| ||||||||| ||||   u
3'      ccu guca   ugc cuauaacc  gccgaguua uuuuucguc cgag   g
   uauuu   u    ccg   a        gu         g         u    uuc 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

Gao et al. identified small RNAs by sequencing in Prunus mume [1]. The reads were mapped to the Prunus persica genome. This entry represents the Prunus persica sequence, but the evidence for mature RNA expression is from Prunus mume.

Genome context

• Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2): chrG3: 21899734-21899848 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from ppe-MIR171a

• ppe-MIR171a: chrG3: 21899734-21899848 [+]
• ppe-MIR171e: chrG3: 21899742-21899838 [-]

Database links

• miRBase Tracker:MI0021623

Mature sequence ppe-miR171a

• Accession: MIMAT0027286
• Sequence: 75 - ugauugagccgugccaauauc - 95
• Evidence: experimental; Illumina [1]

References

1. PMID:22863067 "High-throughput sequencing of small RNAs and analysis of differentially expressed microRNAs associated with pistil development in Japanese apricot" Gao Z, Shi T, Luo X, Zhang Z, Zhuang W, Wang L BMC Genomics. 13:371(2012).