![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ppe-MIR169e |
||||||||
Accession | MI0021629 (change log) | |||||||
Description | Prunus persica miR169e stem-loop | |||||||
Gene family | MIPF0000037; MIR169_2 | |||||||
Literature search |
![]()
7 open access papers mention ppe-MIR169e | |||||||
Stem-loop |
- ug ga u ua ga ------ ua c 5' gagucu caugag ga ggagaguaga ugagccaaggau cuugcca aagca ugg c |||||| |||||| || |||||||||| |||||||||||| ||||||| ||||| ||| u 3' cuuaga guacuc uu ucucucguuu acuugguuccug gaacggu uuugu acc u a gu uc u gc uc cuucua uc u |
|||||||
Confidence |
Annotation confidence: not enough data
| |||||||
Comments |
Gao et al. identified small RNAs by sequencing in Prunus mume [1]. The reads were mapped to the Prunus persica genome. This entry represents the Prunus persica sequence, but the evidence for mature RNA expression is from Prunus mume. |
|||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
|
Mature sequence ppe-miR169e-5p |
|
Accession | MIMAT0031172 |
Sequence |
32 - ugagccaaggaugacuugcca - 52 |
Evidence | experimental; Illumina [2] |
References |
|
1 | |
2 |
PMID:22909020
"Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs"
BMC Plant Biol. 12:149(2012).
|