Stem-loop sequence ppe-MIR169e

AccessionMI0021629 (change log)
DescriptionPrunus persica miR169e stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

7 open access papers mention ppe-MIR169e
(20 sentences)

Stem-loop 
   -      ug      ga  u          ua            ga       ------     ua   c 
5'  gagucu  caugag  ga ggagaguaga  ugagccaaggau  cuugcca      aagca  ugg c
    ||||||  ||||||  || ||||||||||  ||||||||||||  |||||||      |||||  ||| u
3'  cuuaga  guacuc  uu ucucucguuu  acuugguuccug  gaacggu      uuugu  acc u
   a      gu      uc  u          gc            uc       cuucua     uc   u
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Gao et al. identified small RNAs by sequencing in Prunus mume [1]. The reads were mapped to the Prunus persica genome. This entry represents the Prunus persica sequence, but the evidence for mature RNA expression is from Prunus mume.

Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG1: 5644236-5644371 [+]
intergenic
Clustered miRNAs
< 10kb from ppe-MIR169e
ppe-MIR169lchrG1: 5641715-5641875 [-]
ppe-MIR169echrG1: 5644236-5644371 [+]
ppe-MIR169bchrG1: 5647462-5647618 [+]
Database links

Mature sequence ppe-miR169e-5p

Accession MIMAT0031172
Sequence

32 -  

ugagccaaggaugacuugcca

 - 52

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:22863067 "High-throughput sequencing of small RNAs and analysis of differentially expressed microRNAs associated with pistil development in Japanese apricot" Gao Z, Shi T, Luo X, Zhang Z, Zhuang W, Wang L BMC Genomics. 13:371(2012).
2
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).