Stem-loop sequence ppe-MIR171g

Accession

MI0021641 (change log)

Description

Prunus persica miR171g stem-loop

Gene family

MIPF0000030; MIR171_1

Literature search

6 open access papers mention ppe-MIR171g
(16 sentences)

Stem-loop

   aaaaaug  g        a                   ucu    a 
5'        ug gauguugg auggcucaaucaaaucaaa   ccca g
          || |||||||| |||||||||||||||||||   |||| u
3'        ac cuauaacc ugccgaguuaguuuaguuu   gggu a
   uccguug  a        g                   ccu    u 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

Gao et al. identified small RNAs by sequencing in Prunus mume [1]. The reads were mapped to the Prunus persica genome. This entry represents the Prunus persica sequence, but the evidence for mature RNA expression is from Prunus mume.

Genome context

• Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2): chrG5: 13602614-13602708 [-]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0021641

Mature sequence ppe-miR171g

• Accession: MIMAT0027304
• Sequence: 65 - ugauugagccgugccaauauc - 85
• Evidence: experimental; Illumina [1]

References

1. PMID:22863067 "High-throughput sequencing of small RNAs and analysis of differentially expressed microRNAs associated with pistil development in Japanese apricot" Gao Z, Shi T, Luo X, Zhang Z, Zhuang W, Wang L BMC Genomics. 13:371(2012).