Stem-loop sequence ppe-MIR482d

AccessionMI0021652 (change log)
DescriptionPrunus persica miR482d stem-loop
Literature search

2 open access papers mention ppe-MIR482d
(6 sentences)

Stem-loop 
   ----   ccu         c          g     -     a   u    auaauuucucuacauuuuauuaa 
5'     agg   cccagaggc aauggagaug guggc uggga gga ccuc                       u
       |||   ||||||||| |||||||||| ||||| ||||| ||| ||||                       u
3'     ucu   gggucuuug uuaucuuuac caccg acccu ccu gggg                       g
   ccuc   -uu         -          g     u     c   c    auaaaacaguggaggaaucaaaa
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Gao et al. identified small RNAs by sequencing in Prunus mume [1]. The reads were mapped to the Prunus persica genome. This entry represents the Prunus persica sequence, but the evidence for mature RNA expression is from Prunus mume.

Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG8: 11352888-11353031 [-]
intergenic
Database links

Mature sequence ppe-miR482d-5p

Accession MIMAT0031174
Sequence

21 -  

gagauggguggcugggaagga

 - 41

Get sequence
Evidence experimental; Illumina [2]

Mature sequence ppe-miR482d-3p

Accession MIMAT0027315
Sequence

103 -  

ccucccaugccacgcauuucua

 - 124

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:22863067 "High-throughput sequencing of small RNAs and analysis of differentially expressed microRNAs associated with pistil development in Japanese apricot" Gao Z, Shi T, Luo X, Zhang Z, Zhuang W, Wang L BMC Genomics. 13:371(2012).
2
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).