Stem-loop sequence sma-mir-3479

Accession

MI0021826 (change log)

Description

Schistosoma mansoni miR-3479 stem-loop

Gene family

MIPF0001629; mir-3479

Literature search

1 open access papers mention sma-mir-3479
(10 sentences)

Stem-loop

   --c       ug   g   u   u       u  gugu 
5'    auguuug  agg gga guu gugcaau ua    u
      |||||||  ||| ||| ||| ||||||| ||     
3'    uauaaac  ucc cuu caa cacguua au    g
   gga       gu   g   c   u       u  aaau 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (WTSI5): Chr_4.unplaced.SC_0032: 1561284-1561359 [-]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0021826

Mature sequence sma-miR-3479-3p

• Accession: MIMAT0025039
• Sequence: 45 - uauugcacuaaccuucgccuug - 66
• Evidence: not experimental

References

1. PMID:21640815 "Genome-wide identification of novel microRNAs and their target genes in the human parasite Schistosoma mansoni" de Souza Gomes M, Muniyappa MK, Carvalho SG, Guerra-Sa R, Spillane C Genomics. 98:96-111(2011).