Stem-loop sequence sma-mir-61

AccessionMI0021829 (change log)
DescriptionSchistosoma mansoni miR-61 stem-loop
Gene family MIPF0001758; mir-61_2
Literature search

1 open access papers mention sma-mir-61
(2 sentences)

Stem-loop
   gcu      - u      u   -ca    a   u  uu  a  u       
5'    gugggu c cuuucu guc   uggu uag ag  ga gc cacugc 
      |||||| | |||||| |||   |||| ||| ||  || || ||||| u
3'    cacuca g gaaaga cag   acua auu uc  cu cg gugauu 
   cuu      c u      u   uac    c   -  uc  a  u       
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WTSI5) Overlapping transcripts
Chr_2: 25390606-25390703 [+]
intergenic
Database links

Mature sequence sma-miR-61-5p

Accession MIMAT0032138
Sequence

3 - 

ugugggucucuuucuuguccau

 - 24

Get sequence
Evidence experimental; Illumina [2], SOLiD [2]

Mature sequence sma-miR-61-3p

Accession MIMAT0025042
Previous IDssma-miR-61
Sequence

76 - 

ugacuagaaagugcacucacuu

 - 97

Get sequence
Evidence experimental; Illumina [2], SOLiD [2]

References

1
PMID:21640815 "Genome-wide identification of novel microRNAs and their target genes in the human parasite Schistosoma mansoni" de Souza Gomes M, Muniyappa MK, Carvalho SG, Guerra-Sa R, Spillane C Genomics. 98:96-111(2011).
2
PMID:24069470 "Sex-biased expression of microRNAs in Schistosoma mansoni" Marco A, Kozomara A, Hui JH, Emery AM, Rollinson D, Griffiths-Jones S, Ronshaugen M PLoS Negl Trop Dis. 7:e2402(2013).