Stem-loop sequence rno-mir-344i

AccessionMI0021834 (change log)
DescriptionRattus norvegicus miR-344i stem-loop
Gene family MIPF0000267; mir-344
Literature search

7 open access papers mention rno-mir-344i
(16 sentences)

Stem-loop 
   ---------aca    -uuu    a       u            ------     u 
5'             gggc    ugca gucaggc ccuggcuggagu      ccagc c
               ||||    |||| ||||||| ||||||||||||      ||||| u
3'             cucg    acgu caguucg ggaccgaucucg      ggucg a
   gggaagagauaa    ucuc    -       -            gaccua     a
Get sequence
Deep sequencing
860 reads, 0 reads per million, 86 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr1: 122506559-122506657 [-]
intergenic
Database links

Mature sequence rno-miR-344i

Accession MIMAT0025049
Sequence

58 -  

cucuagccagggcuugacugca

 - 79

Get sequence
Deep sequencing540 reads, 69 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22605339 "Limonoid compounds inhibit sphingomyelin biosynthesis by preventing CERT protein-dependent extraction of ceramides from the endoplasmic reticulum" Hullin-Matsuda F, Tomishige N, Sakai S, Ishitsuka R, Ishii K, Makino A, Greimel P, Abe M, Laviad EL, Lagarde M, Vidal H, Saito T, Osada H, Hanada K, Futerman AH, Kobayashi T J Biol Chem. 287:24397-24411(2012).
2
PMID:22908386 "MicroRNAs in the pineal gland: miR-483 regulates melatonin synthesis by targeting arylalkylamine N-acetyltransferase" Clokie SJ, Lau P, Kim HH, Coon SL, Klein DC J Biol Chem. 287:25312-25324(2012).