![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-344i |
|||||
Accession | MI0021834 (change log) | ||||
Description | Rattus norvegicus miR-344i stem-loop | ||||
Gene family | MIPF0000267; mir-344 | ||||
Literature search |
![]()
7 open access papers mention rno-mir-344i | ||||
Stem-loop |
---------aca -uuu a u ------ u 5' gggc ugca gucaggc ccuggcuggagu ccagc c |||| |||| ||||||| |||||||||||| ||||| u 3' cucg acgu caguucg ggaccgaucucg ggucg a gggaagagauaa ucuc - - gaccua a |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence rno-miR-344i |
|
Accession | MIMAT0025049 |
Sequence |
58 - cucuagccagggcuugacugca - 79 |
Deep sequencing | 540 reads, 69 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:22605339
"Limonoid compounds inhibit sphingomyelin biosynthesis by preventing CERT protein-dependent extraction of ceramides from the endoplasmic reticulum"
J Biol Chem. 287:24397-24411(2012).
|
2 |
PMID:22908386
"MicroRNAs in the pineal gland: miR-483 regulates melatonin synthesis by targeting arylalkylamine N-acetyltransferase"
J Biol Chem. 287:25312-25324(2012).
|