Stem-loop sequence rno-mir-6321

AccessionMI0021844 (change log)
DescriptionRattus norvegicus miR-6321 stem-loop
Stem-loop
   ucga  g  --gaag  -   - gu    -gu   -     gu   u        -   uu      a  -  cag 
5'     gu uu      uc uca g  agca   gcu caugg  cuc acugcagu gag  cuauga gc cu   g
       || ||      || ||| |  ||||   ||| |||||  ||| |||||||| |||  |||||| || ||    
3'     cg aa      gg agu c  ucgu   cga guauc  gag ugacguua cuc  gguacu cg ga   u
   ---g  g  gaagaa  u   a uc    aac   a     uu   -        u   ug      -  u  cga 
Get sequence
Deep sequencing
2722 reads, 0 reads per million, 234 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr14: 21097338-21097478 [-]
sense
ENSRNOT00000004776 ; Rufy3-202; exon 6
ENSRNOT00000020608 ; Rufy3-201; exon 7
Database links

Mature sequence rno-miR-6321

Accession MIMAT0025059
Sequence

41 - 

uacugcagugaguucuaugaagc

 - 63

Get sequence
Deep sequencing2441 reads, 192 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22605339 "Limonoid compounds inhibit sphingomyelin biosynthesis by preventing CERT protein-dependent extraction of ceramides from the endoplasmic reticulum" Hullin-Matsuda F, Tomishige N, Sakai S, Ishitsuka R, Ishii K, Makino A, Greimel P, Abe M, Laviad EL, Lagarde M, Vidal H, Saito T, Osada H, Hanada K, Futerman AH, Kobayashi T J Biol Chem. 287:24397-24411(2012).
2
PMID:22908386 "MicroRNAs in the pineal gland: miR-483 regulates melatonin synthesis by targeting arylalkylamine N-acetyltransferase" Clokie SJ, Lau P, Kim HH, Coon SL, Klein DC J Biol Chem. 287:25312-25324(2012).