Stem-loop sequence mmu-mir-6343

AccessionMI0021871 (change log)
Symbol MGI:Mir6343
DescriptionMus musculus miR-6343 stem-loop
Stem-loop
   --u    a     a     --    gaa        c   cugg 
5'    ucag uagcu uuuau  ugca   aagugggg agc    c
      |||| ||||| |||||  ||||   |||||||| |||     
3'    aguc gucga ggaug  augu   uucaccuc uug    a
   cac    a     -     aa    auc        -   uauu 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr1: 76509560-76509643 [+]
intergenic
Database links

Mature sequence mmu-miR-6343

Accession MIMAT0025086
Sequence

61 - 

uguaaaguaggagcugacugac

 - 82

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).