Stem-loop sequence mmu-mir-6346

AccessionMI0021874 (change log)
Symbol MGI:Mir6346
DescriptionMus musculus miR-6346 stem-loop
Stem-loop
   -g     gg      g   caa  ccag     ---   aaccu 
5'   uggca  gcagau acc   gu    aucgu   ugg     a
     |||||  |||||| |||   ||    |||||   |||     u
3'   accgu  cgucug ugg   cg    uagca   acc     a
   aa     aa      -   --a  ---a     uag   gaaau 
Get sequence
Deep sequencing
2 reads, 50 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr1: 118954220-118954300 [+]
antisense
OTTMUST00000088500 ; Gli2-008; intron 1
OTTMUST00000088501 ; Gli2-009; intron 1
OTTMUST00000088493 ; Gli2-001; intron 2
OTTMUST00000088495 ; Gli2-003; intron 2
OTTMUST00000088497 ; Gli2-005; intron 2
OTTMUST00000088498 ; Gli2-006; intron 2
OTTMUST00000088499 ; Gli2-007; intron 2
OTTMUST00000088496 ; Gli2-004; intron 2
OTTMUST00000088494 ; Gli2-002; intron 3
ENSMUST00000162607 ; Gli2-008; intron 1
ENSMUST00000159678 ; Gli2-009; intron 1
ENSMUST00000062483 ; Gli2-001; intron 2
ENSMUST00000162552 ; Gli2-003; intron 2
ENSMUST00000161056 ; Gli2-005; intron 2
ENSMUST00000160991 ; Gli2-006; intron 2
ENSMUST00000159839 ; Gli2-007; intron 2
ENSMUST00000161451 ; Gli2-004; intron 2
ENSMUST00000161301 ; Gli2-002; intron 3
Database links

Mature sequence mmu-miR-6346

Accession MIMAT0025089
Sequence

59 - 

uagcaggugucugcaaugccaa

 - 80

Get sequence
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).