Stem-loop sequence mmu-mir-6352

AccessionMI0021880 (change log)
Symbol MGI:Mir6352
DescriptionMus musculus miR-6352 stem-loop
Stem-loop
   u      a    g     --u     ---a    cc   g u    u -aa  -     ac 
5'  cauuuc uuuu accuu   gggaa    agga  cca c cugg g   uc cugag  u
    |||||| |||| |||||   |||||    ||||  ||| | |||| |   || |||||  u
3'  guagag gagg uggag   uccuu    uucu  ggu g gacc c   ag gauuc  g
   g      -    g     ucu     gucg    aa   - u    u gac  u     cu 
Get sequence
Deep sequencing
6 reads, 83.3 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr1: 77496653-77496768 [-]
sense
ENSMUST00000027451 ; Epha4-201; intron 3
Database links

Mature sequence mmu-miR-6352

Accession MIMAT0025095
Sequence

17 - 

uuugggaaaaggaccccagcuc

 - 38

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).