Stem-loop sequence mmu-mir-6363

AccessionMI0021892 (change log)
Symbol MGI:Mir6363
DescriptionMus musculus miR-6363 stem-loop
Literature search

1 open access papers mention mmu-mir-6363
(1 sentences)

Stem-loop
   c    -uu  c         c   c   -   aaau   --     ---   -   cu u au 
5'  aggc   ua uuuuucaau uuu gag aua    ucc  ucuac   gug guc  g g  u
    ||||   || ||||||||| ||| ||| |||    |||  |||||   ||| |||  | |   
3'  uccg   au aagagguua aaa cuc ugu    agg  agaug   cac cag  c c  g
   c    ucc  c         -   -   c   ---c   uc     ucu   g   -u u cu 
Get sequence
Deep sequencing
230 reads, 305 reads per million, 21 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr16: 50727132-50727245 [+]
intergenic
Database links

Mature sequence mmu-miR-6363

Accession MIMAT0025107
Sequence

73 - 

uguagacuggacuguccucaaa

 - 94

Get sequence
Deep sequencing227 reads, 20 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).