Stem-loop sequence mmu-mir-6376

AccessionMI0021905 (change log)
Symbol MGI:Mir6376
DescriptionMus musculus miR-6376 stem-loop
Stem-loop
   u    -ca       -cc    ca  acuu  u   a    --   ca          a   acca   c 
5'  agcc   guguucu   aguc  ug    cc cac gugu  ggc  auuggagauu uga    uga u
    ||||   |||||||   ||||  ||    || ||| ||||  |||  |||||||||| |||    |||  
3'  ucgg   cauaagg   uuag  ac    gg gug cacg  ucg  uaaucuuuga acu    gcu g
   c    aaa       aau    ac  ----  u   -    ac   --          c   accc   c 
Get sequence
Deep sequencing
13 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr6: 88104128-88104258 [-]
antisense
ENSMUST00000032143 ; Rpn1-201; exon 10
Database links

Mature sequence mmu-miR-6376

Accession MIMAT0025120
Sequence

34 - 

caguguggccaauuggagauua

 - 55

Get sequence
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).