Stem-loop sequence mmu-mir-6411

AccessionMI0021948 (change log)
Symbol MGI:Mir6411
DescriptionMus musculus miR-6411 stem-loop
Stem-loop
   a         -ca  u   -cu u       g -   --a     u   - uuauc 
5'  uccugguug   ug gga   g agcaugu u agu   cauaa gau c     a
    |||||||||   || |||   | ||||||| | |||   ||||| ||| |      
3'  aggaccgau   ac ucu   c ucguacg a uua   guguu cua g     a
   a         caa  u   cuu u       g c   gaa     c   u ucuac 
Get sequence
Deep sequencing
6 reads, 1.1e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr10: 104287269-104287376 [+]
intergenic
Database links

Mature sequence mmu-miR-6411

Accession MIMAT0025164
Sequence

22 - 

uagcauguguaguacauaaug

 - 42

Get sequence
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).