Stem-loop sequence ptc-MIR3627a

AccessionMI0022035 (change log)
DescriptionPopulus trichocarpa miR3627a stem-loop
Literature search

1 open access papers mention ptc-MIR3627a
(3 sentences)

Stem-loop 
      uu   ---                 u    a      a    gg   -  -    ua 
5' ggu  ggg   gaggggaguucugucgc ggaa gauggu ccua  gcu gc auau  a
   |||  |||   ||||||||||||||||| |||| |||||| ||||  ||| || ||||   
3' cca  ucc   cuccccucaaggcagcg ccuu cuacca ggau  cga cg uaug  u
      uc   aau                 c    -      c    aa   a  a    ug
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000353.2: 10902822-10902937 [+]
intergenic
Database links

Mature sequence ptc-miR3627a

Accession MIMAT0025263
Sequence

18 -  

ucugucgcuggaaagaugguac

 - 39

Get sequence
Evidence experimental; miRNAseq [1], Illumina [2]

References

1
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).
2
PMID:23570526 "Identification of drought-responsive and novel Populus trichocarpa microRNAs by high-throughput sequencing and their targets using degradome analysis" Shuai P, Liang D, Zhang Z, Yin W, Xia X BMC Genomics. 14:233(2013).