Stem-loop sequence ssc-mir-551a

AccessionMI0022153 (change log)
DescriptionSus scrofa miR-551a stem-loop
Gene family MIPF0000360; mir-551
Literature search

1 open access papers mention ssc-mir-551a
(1 sentences)

Stem-loop
   u  ug   c        c    c    gag     ucuga 
5'  gg  acc uggaaauc agag gggu   gccug     c
    ||  ||| |||||||| |||| ||||   |||||      
3'  cc  ugg accuuugg ucuc ccca   cggau     u
   c  gu   u        u    a    --g     cuuug 
Get sequence
Deep sequencing
7 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr6: 59927697-59927776 [+]
sense
ENSSSCT00000021529 ; ssc-mir-551a.1-201; exon 1
Database links

Mature sequence ssc-miR-551a

Accession MIMAT0025379
Sequence

51 - 

gcgacccacucuugguuucc

 - 70

Get sequence
Deep sequencing7 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).