Stem-loop sequence bta-mir-2285p

AccessionMI0022274 (change log)
DescriptionBos taurus miR-2285p stem-loop
Gene family MIPF0000747; mir-2284
Literature search

11 open access papers mention bta-mir-2285p
(15 sentences)

Stem-loop 
   a           a  uu       ug             c 
5'  cuggguuggcc aa  guucauu  gguuuuuccguaa a
    ||||||||||| ||  |||||||  |||||||||||||  
3'  gacccgacugg uu  caaguga  ucaaaaagguauu u
   -           g  uu       gu             c
Get sequence
Deep sequencing
191 reads, 3.33 reads per million, 60 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr13: 36776800-36776880 [+]
sense
ENSBTAT00000036314 ; MPP7-201; intron 1
Database links

Mature sequence bta-miR-2285p

Accession MIMAT0025532
Sequence

50 -  

aaaaacuugagugaacuuuugg

 - 71

Get sequence
Deep sequencing136 reads, 58 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).
2
PMID:23100578 "Profiling of differentially expressed microRNA and the bioinformatic target gene analyses in bovine fast- and slow-type muscles by massively parallel sequencing" Muroya S, Taniguchi M, Shibata M, Oe M, Ojima K, Nakajima I, Chikuni K J Anim Sci. 91:90-103(2013).