![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mdm-MIR156a |
|||||
Accession | MI0022971 (change log) | ||||
Description | Malus domestica miR156a stem-loop | ||||
Gene family | MIPF0000008; MIR156 | ||||
Literature search |
![]()
15 open access papers mention mdm-MIR156a | ||||
Stem-loop |
a - - a a g g yaauu aa 5' aguugac ga agaga gugagcac cac g c g guau a ||||||| || ||||| |||||||| ||| | | | |||| 3' ucgacug cu ucucu cacucgug gug c g u caua a c c u c g g g --uuy cu |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence mdm-miR156a |
|
Accession | MIMAT0025867 |
Sequence |
4 - ugacagaagagagugagcac - 23 |
Evidence | experimental; miRNAseq [1] |
References |
|
1 |
PMID:22704043
"Apple miRNAs and tasiRNAs with novel regulatory networks"
Genome Biol. 13:R47(2012).
|