![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mdm-MIR171a |
|
Accession | MI0023042 (change log) |
Description | Malus domestica miR171a stem-loop |
Gene family | MIPF0000030; MIR171_1 |
Literature search |
![]()
9 open access papers mention mdm-MIR171a |
Stem-loop |
ga c u - r cuyauauu g 5' agguauugacgcg cucaauu gaa cg gugg g a ||||||||||||| ||||||| ||| || |||| | 3' ucuauaacugcgc gaguuag cuu gc uacc c g cc c u a g ----aauu a |
Confidence |
Annotation confidence: not enough data
|
Database links |
|
Mature sequence mdm-miR171a |
|
Accession | MIMAT0025938 |
Sequence |
67 - uugagccgcgucaauaucucc - 87 |
Evidence | experimental; miRNAseq [1] |
References |
|
1 |
PMID:22704043
"Apple miRNAs and tasiRNAs with novel regulatory networks"
Genome Biol. 13:R47(2012).
|