![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mdm-MIR171h |
|||||
Accession | MI0023049 (change log) | ||||
Description | Malus domestica miR171h stem-loop | ||||
Gene family | MIPF0000030; MIR171_1 | ||||
Literature search |
![]()
9 open access papers mention mdm-MIR171h | ||||
Stem-loop |
a a ucu a 5' gauguugg auggcucaaucaaau aaa cccaa g |||||||| ||||||||||||||| ||| ||||| 3' cuauaacc ugccgaguuaguuua uuu ggguu g g a ucu a |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence mdm-miR171h |
|
Accession | MIMAT0025945 |
Sequence |
56 - ugauugagccgugccaauauc - 76 |
Evidence | experimental; miRNAseq [1] |
References |
|
1 |
PMID:22704043
"Apple miRNAs and tasiRNAs with novel regulatory networks"
Genome Biol. 13:R47(2012).
|