![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mdm-MIR171l |
|||||
Accession | MI0023053 (change log) | ||||
Description | Malus domestica miR171l stem-loop | ||||
Gene family | MIPF0000030; MIR171_1 | ||||
Literature search |
![]()
9 open access papers mention mdm-MIR171l | ||||
Stem-loop |
c a c a ca -a uc 5' gagaaag gauguuggug gguucaauc ga ga gauuuac ca c ||||||| |||||||||| ||||||||| || || ||||||| || c 3' uucuuuc cuauaaccgc ccgaguuag cu cu uuaaaug gu u a g a - ag cg cg |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence mdm-miR171l |
|
Accession | MIMAT0025949 |
Sequence |
74 - uugagccgcgccaauaucacu - 94 |
Evidence | experimental; miRNAseq [1] |
References |
|
1 |
PMID:22704043
"Apple miRNAs and tasiRNAs with novel regulatory networks"
Genome Biol. 13:R47(2012).
|