![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mdm-MIR396d |
||||||
Accession | MI0023096 (change log) | |||||
Description | Malus domestica miR396d stem-loop | |||||
Gene family | MIPF0000047; MIR396 | |||||
Literature search |
![]()
8 open access papers mention mdm-MIR396d | |||||
Stem-loop |
c a aauucum - aaauc 5' gccaug uuuuccacagcuuucuuga cuuc ugcug ucu u |||||| ||||||||||||||||||| |||| ||||| ||| 3' cgguac agagggugucgaaagaacu gaag acgau agg c c c --guacc u ccuuu |
|||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence mdm-miR396d |
|
Accession | MIMAT0025992 |
Sequence |
10 - uuccacagcuuucuugaacuu - 30 |
Evidence | experimental; miRNAseq [1] |
References |
|
1 |
PMID:22704043
"Apple miRNAs and tasiRNAs with novel regulatory networks"
Genome Biol. 13:R47(2012).
|