Stem-loop sequence mdm-MIR2111a

AccessionMI0023118 (change log)
DescriptionMalus domestica miR2111a stem-loop
Gene family MIPF0000754; MIR2111
Literature search

2 open access papers mention mdm-MIR2111a
(2 sentences)

Stem-loop
      u     u               ug   u      -     caca 
5' ggu aggau ggguaaucugcaucc  agg uuagau cagca    c
   ||| ||||| |||||||||||||||  ||| |||||| |||||     
3' ccg uccug uccauuagacguagg  ucc gaucua guugu    g
      u     u               gu   u      u     uuau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC000075.129: 2663-2757 [+]
intergenic
Database links

Mature sequence mdm-miR2111a

Accession MIMAT0026014
Sequence

14 - 

uaaucugcauccugagguuua

 - 34

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).