Stem-loop sequence mdm-MIR2118a

AccessionMI0023138 (change log)
DescriptionMalus domestica miR2118a stem-loop
Gene family MIPF0001409; MIR2118_2
Literature search

1 open access papers mention mdm-MIR2118a
(5 sentences)

Stem-loop
            -           aaa   uuu           u         a  -     --     aacauu     ucu 
5' gagagaagg gggaaagggag   gag   gaggaaguuau ggacuuagu gc ucggu  gagaa      gagga   g
   ||||||||| |||||||||||   |||   ||||||||||| ||||||||| || |||||  |||||      |||||    
3' cuuuuuucc cccuuuuccuc   cuc   cuccuuuagua ccugaauca cg agcca  cucuu      cuucu   g
            a           ---   cgu           c         c  u     uc     ------     uga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC017130.228: 6718-6868 [+]
intergenic
Database links

Mature sequence mdm-miR2118a

Accession MIMAT0026034
Sequence

93 - 

cuaccgaugccacuaaguccca

 - 114

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).