Stem-loop sequence mdm-MIR2118b

AccessionMI0023139 (change log)
DescriptionMalus domestica miR2118b stem-loop
Gene family MIPF0001409; MIR2118_2
Literature search

1 open access papers mention mdm-MIR2118b
(5 sentences)

Stem-loop
       uu           a         u  -     --     aaccu   gau 
5' gagg  gaggaaguuau ggacuuagu gc ucggu  gagaa     gau   c
   ||||  ||||||||||| ||||||||| || |||||  |||||     |||    
3' cucc  cuccuuuagua ccugaauca cg agcca  cucuu     cug   u
       cu           c         c  u     uc     -cuuc   agg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC019300.125: 1293-1398 [-]
intergenic
Database links

Mature sequence mdm-miR2118b

Accession MIMAT0026035
Sequence

69 - 

cuaccgaugccacuaaguccca

 - 90

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).