Stem-loop sequence mdm-MIR7120a

AccessionMI0023141 (change log)
DescriptionMalus domestica miR7120a stem-loop
Gene family MIPF0001516; MIR7120
Stem-loop
                   u         uu       c  aug    u                              u        cauu 
5' auguauguauauguau aaaauguuc  uugccag ca   uggc uguuauauugucagauugucaaucugaacc uuaauuac    a
   |||||||||||||||| |||||||||  ||||||| ||   |||| |||||||||||||||||||||||||||||| ||||||||    a
3' uauauauauauacaua uuuuacgag  aacgguu gu   accg gcaauauaacagucugacaguuagacuugg aauuaaug    u
                   c         uu       u  caa    u                              u        cauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC017840.207: 3632-3812 [+]
intergenic
Database links

Mature sequence mdm-miR7120a-5p

Accession MIMAT0026037
Sequence

47 - 

uguuauauugucagauuguca

 - 67

Get sequence
Evidence experimental; miRNAseq [1]

Mature sequence mdm-miR7120a-3p

Accession MIMAT0037472
Sequence

118 - 

cagucugacaauauaacgugc

 - 138

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).
2
"Identification of apple miRNAs and their potential role in fire blight resistance" Kaja E, Szczesniak MW, Jensen PJ, Axtell MJ, McNellis T, Makalowska I Trees Genet Genomes. 11:812(2014).