Stem-loop sequence mdm-MIR7120b

AccessionMI0023142 (change log)
DescriptionMalus domestica miR7120b stem-loop
Gene family MIPF0001516; MIR7120
                   u         uu       c  aug    u                              u        cauu 
5' auguauguauauguau aaaauguuc  uugccag ca   uggc uguuauauugucagauugucaaucugaacc uuaauuac    a
   |||||||||||||||| |||||||||  ||||||| ||   |||| |||||||||||||||||||||||||||||| ||||||||    a
3' uauauauauauacaua uuuuacgag  aacgguu gu   accg gcaauauaacagucugacaguuagacuugg aauuaaug    u
                   c         uu       u  caa    u                              u        cauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC019554.272: 10041-10221 [-]
Database links

Mature sequence mdm-miR7120b-5p

Accession MIMAT0026038

47 - 


 - 67

Get sequence
Evidence experimental; miRNAseq [1]

Mature sequence mdm-miR7120b-3p

Accession MIMAT0037473

118 - 


 - 138

Get sequence
Evidence experimental; Illumina [2]


PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).
"Identification of apple miRNAs and their potential role in fire blight resistance" Kaja E, Szczesniak MW, Jensen PJ, Axtell MJ, McNellis T, Makalowska I Trees Genet Genomes. 11:812(2014).