Stem-loop sequence mdm-MIR7122a

AccessionMI0023152 (change log)
DescriptionMalus domestica miR7122a stem-loop
Gene family MIPF0000771; MIR1509
Stem-loop
          uuc   uc               u      c     -caaaacuc   -    u 
5' ggguuca   cau  uuuuauacagagaaa cacggu gagau         aga aguc g
   |||||||   |||  ||||||||||||||| |||||| |||||         ||| |||| u
3' ccuaggu   gua  gaaauaugucuuuuu gugcca cucug         ucu uuag c
          cau   ga               -      a     cugccucuc   c    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC009778.59: 4653-4774 [-]
intergenic
Database links

Mature sequence mdm-miR7122a

Accession MIMAT0026048
Sequence

18 - 

uuauacagagaaaucacggucg

 - 39

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).