Stem-loop sequence ssc-mir-7135

AccessionMI0023568 (change log)
DescriptionSus scrofa miR-7135 stem-loop
Stem-loop
   --u   u       u   -u     gg  u 
5'    cuc gagacac gac  guggg  ua g
      ||| ||||||| |||  |||||  ||  
3'    gag cucugug cug  uaccu  gu u
   gac   u       u   uc     gu  g 
Get sequence
Deep sequencing
14 reads, 0 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr3: 29052266-29052324 [+]
sense
Database links

Mature sequence ssc-miR-7135-5p

Accession MIMAT0028145
Sequence

1 - 

ucucugagacacugacugugg

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssc-miR-7135-3p

Accession MIMAT0028146
Sequence

38 - 

aucugucugugucucugagcag

 - 59

Get sequence
Deep sequencing14 reads, 7 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22953717 "Profiling microRNAs in lung tissue from pigs infected with Actinobacillus pleuropneumoniae" Podolska A, Anthon C, Bak M, Tommerup N, Skovgaard K, Heegaard PM, Gorodkin J, Cirera S, Fredholm M BMC Genomics. 13:459(2012).