Stem-loop sequence ssc-mir-7137

AccessionMI0023570 (change log)
DescriptionSus scrofa miR-7137 stem-loop
Stem-loop
   cgg                     cacuc 
5'    gggaacucccagaccagcuuc     c
      |||||||||||||||||||||      
3'    cccuugagggucuggucgaag     c
   ggg                     aacuu 
Get sequence
Deep sequencing
125 reads, 0 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr3: 10664432-10664491 [+]
sense
ENSSSCT00000008456 ; WBSCR22-201; intron 7
Database links

Mature sequence ssc-miR-7137-5p

Accession MIMAT0028149
Sequence

1 - 

cgggggaacucccagaccagc

 - 21

Get sequence
Deep sequencing8 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence ssc-miR-7137-3p

Accession MIMAT0028150
Sequence

39 - 

agcuggucugggaguucccggg

 - 60

Get sequence
Deep sequencing117 reads, 12 experiments
Evidence experimental; Illumina [1-2]

References

1
PMID:22953717 "Profiling microRNAs in lung tissue from pigs infected with Actinobacillus pleuropneumoniae" Podolska A, Anthon C, Bak M, Tommerup N, Skovgaard K, Heegaard PM, Gorodkin J, Cirera S, Fredholm M BMC Genomics. 13:459(2012).
2
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).