Stem-loop sequence ssc-mir-7139

AccessionMI0023572 (change log)
DescriptionSus scrofa miR-7139 stem-loop
Literature search

1 open access papers mention ssc-mir-7139
(2 sentences)

Stem-loop
   --c      uucg       a    aaaaau 
5'    cauucc    ucugugc cuag      a
      ||||||    ||||||| ||||       
3'    guaggg    ggacacg gauc      a
   gga      --ua       g    caugac 
Get sequence
Deep sequencing
4 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr5: 109259471-109259530 [+]
sense
ENSSSCT00000001039 ; E2F7-201; intron 2
Database links

Mature sequence ssc-miR-7139-5p

Accession MIMAT0028153
Sequence

1 - 

ccauuccuucgucugugcacuag

 - 23

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

Mature sequence ssc-miR-7139-3p

Accession MIMAT0028154
Sequence

39 - 

uagggcacaggaugggaugagg

 - 60

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22953717 "Profiling microRNAs in lung tissue from pigs infected with Actinobacillus pleuropneumoniae" Podolska A, Anthon C, Bak M, Tommerup N, Skovgaard K, Heegaard PM, Gorodkin J, Cirera S, Fredholm M BMC Genomics. 13:459(2012).