Stem-loop sequence ssc-mir-7141

AccessionMI0023574 (change log)
DescriptionSus scrofa miR-7141 stem-loop
Stem-loop
   --                    ca         uu 
5'   gacgguuuggacguuaagaa  auucauaua  u
     ||||||||||||||||||||  |||||||||   
3'   uugccaaaccugcaauucuu  uaaguauau  u
   cc                    cc         ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr15: 151429201-151429270 [+]
intergenic
Database links

Mature sequence ssc-miR-7141-5p

Accession MIMAT0028157
Sequence

1 - 

gacgguuuggacguuaagaac

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssc-miR-7141-3p

Accession MIMAT0028158
Sequence

50 - 

ucuuaacguccaaaccguucc

 - 70

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22953717 "Profiling microRNAs in lung tissue from pigs infected with Actinobacillus pleuropneumoniae" Podolska A, Anthon C, Bak M, Tommerup N, Skovgaard K, Heegaard PM, Gorodkin J, Cirera S, Fredholm M BMC Genomics. 13:459(2012).