Stem-loop sequence ssc-mir-7143

AccessionMI0023576 (change log)
DescriptionSus scrofa miR-7143 stem-loop
Gene family MIPF0002024; mir-7143
Stem-loop
   -a  -       c g           cu  u 
5'   ag cucagcu u aagugcagagg  gu u
     || ||||||| | |||||||||||  ||  
3'   uc gagucga a uucacgucucc  ca g
   ag  a       - g           uu  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr9: 31199350-31199410 [+]
intergenic
chrUScaf1441: 36265-36325 [-]
intergenic
Database links

Mature sequence ssc-miR-7143-5p

Accession MIMAT0028161
Sequence

1 - 

aagcucagcucugaagugcagagg

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssc-miR-7143-3p

Accession MIMAT0028162
Sequence

39 - 

ucugcacuugaagcugagacuga

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22953717 "Profiling microRNAs in lung tissue from pigs infected with Actinobacillus pleuropneumoniae" Podolska A, Anthon C, Bak M, Tommerup N, Skovgaard K, Heegaard PM, Gorodkin J, Cirera S, Fredholm M BMC Genomics. 13:459(2012).