Stem-loop sequence ssc-mir-7144

AccessionMI0023577 (change log)
DescriptionSus scrofa miR-7144 stem-loop
Literature search

1 open access papers mention ssc-mir-7144
(1 sentences)

Stem-loop
   --acuu  c      uu       uuc 
5'       uc cgggau  ggagcgc   c
         || ||||||  |||||||    
3'       ag gcccug  ccucgcg   g
   agcgcc  a      uu       cac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr11: 81643736-81643789 [+]
antisense
ENSSSCT00000010454 ; ssc-mir-7144.1-201; exon 1
Database links

Mature sequence ssc-miR-7144-5p

Accession MIMAT0028163
Sequence

1 - 

acuuucccgggauuuggagcgc

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssc-miR-7144-3p

Accession MIMAT0028164
Sequence

33 - 

gcuccuugucccgagaccgcga

 - 54

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22953717 "Profiling microRNAs in lung tissue from pigs infected with Actinobacillus pleuropneumoniae" Podolska A, Anthon C, Bak M, Tommerup N, Skovgaard K, Heegaard PM, Gorodkin J, Cirera S, Fredholm M BMC Genomics. 13:459(2012).