Stem-loop sequence dev-mir-D1

AccessionMI0023580 (change log)
DescriptionDuck enteritis virus miR-D1 stem-loop
Stem-loop
      u  u    a  g   g     ca   uugua 
5' gca gc uggg au gcg aagag  gac     u
   ||| || |||| || ||| |||||  |||      
3' cgu ug accc ua cgc uucuc  cug     a
      u  c    c  g   g     --   uaaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence dev-miR-D1-5p

Accession MIMAT0028169
Sequence

7 - 

uugggaauggcggaagagcagacu

 - 30

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dev-miR-D1-3p

Accession MIMAT0028170
Sequence

43 - 

uccucuugcgcgauccccacgu

 - 64

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22492913 "Novel microRNAs encoded by duck enteritis virus" Yao Y, Smith LP, Petherbridge L, Watson M, Nair V J Gen Virol. 93:1530-1536(2012).