Stem-loop sequence dev-mir-D3

AccessionMI0023582 (change log)
DescriptionDuck enteritis virus miR-D3 stem-loop
Stem-loop
          gu   ag    g    uacu 
5' uauauaa  cac  ggcg cagc    g
   |||||||  |||  |||| ||||    g
3' guguguu  gug  uugc guug    u
          ug   gu    -    uuac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence dev-miR-D3-3p

Accession MIMAT0028172
Sequence

32 - 

auuguugcguuuggugguuugug

 - 54

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22492913 "Novel microRNAs encoded by duck enteritis virus" Yao Y, Smith LP, Petherbridge L, Watson M, Nair V J Gen Virol. 93:1530-1536(2012).