Stem-loop sequence dev-mir-D4

AccessionMI0023583 (change log)
DescriptionDuck enteritis virus miR-D4 stem-loop
Stem-loop
   gc     c    cg  u    --     cg    uguc 
5'   uaaaa agca  cc aauc  acaau  guau    g
     ||||| ||||  || ||||  |||||  ||||     
3'   guuuu ucgu  gg uuag  uguua  uaua    u
   cu     u    au  -    gc     au    uggg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence dev-miR-D4-3p

Accession MIMAT0028173
Sequence

46 - 

uuaauugucggauugguaugcuuuuu

 - 71

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22492913 "Novel microRNAs encoded by duck enteritis virus" Yao Y, Smith LP, Petherbridge L, Watson M, Nair V J Gen Virol. 93:1530-1536(2012).