Stem-loop sequence dev-mir-D6

AccessionMI0023585 (change log)
DescriptionDuck enteritis virus miR-D6 stem-loop
Stem-loop
       u     a    ac           ucuc 
5' cgcc uugac cacc  cauucuggccg    g
   |||| ||||| ||||  |||||||||||     
3' gcgg agcug gugg  gugagacuggc    u
       c     a    cu           uuuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence dev-miR-D6-5p

Accession MIMAT0028175
Sequence

7 - 

ugacacaccaccauucuggccg

 - 28

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dev-miR-D6-3p

Accession MIMAT0028176
Sequence

41 - 

gucagagugucggugagucgacg

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22492913 "Novel microRNAs encoded by duck enteritis virus" Yao Y, Smith LP, Petherbridge L, Watson M, Nair V J Gen Virol. 93:1530-1536(2012).