Stem-loop sequence dev-mir-D7

AccessionMI0023586 (change log)
DescriptionDuck enteritis virus miR-D7 stem-loop
Stem-loop
      cc    ua       -----  aa     uu     gcg 
5' gca  uucg  gcggcgu     au  ugguu  cgcuc   a
   |||  ||||  |||||||     ||  |||||  |||||    
3' ugu  aggc  cgccgca     ug  accag  guggg   g
      ca    --       aauac  aa     uc     guc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence dev-miR-D7-5p

Accession MIMAT0028177
Sequence

6 - 

uucguagcggcguauaaugguuu

 - 28

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22492913 "Novel microRNAs encoded by duck enteritis virus" Yao Y, Smith LP, Petherbridge L, Watson M, Nair V J Gen Virol. 93:1530-1536(2012).