Stem-loop sequence dev-mir-D8

AccessionMI0023587 (change log)
DescriptionDuck enteritis virus miR-D8 stem-loop
Stem-loop
       cu   u      u     a    cucgua 
5' gaag  gcc cccgau aaacu uacg      u
   ||||  ||| |||||| ||||| ||||      u
3' cuuc  ugg ggguug uuuga augc      u
       uu   c      c     c    acaaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence dev-miR-D8-5p

Accession MIMAT0028178
Sequence

6 - 

ugccucccgauuaaacuauacgc

 - 28

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dev-miR-D8-3p

Accession MIMAT0028179
Sequence

45 - 

uacaguuucguugggcgguuuc

 - 66

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22492913 "Novel microRNAs encoded by duck enteritis virus" Yao Y, Smith LP, Petherbridge L, Watson M, Nair V J Gen Virol. 93:1530-1536(2012).