Stem-loop sequence dev-mir-D10

AccessionMI0023589 (change log)
DescriptionDuck enteritis virus miR-D10 stem-loop
Stem-loop
      g  -        a    a   uuuu   u a 
5' gca ga ggacgggc agaa cuc    gcc g g
   ||| || |||||||| |||| |||    ||| | a
3' cgu cu ucugcccg ucuu gag    cgg c a
      g  a        a    -   -uuu   u u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence dev-miR-D10-3p

Accession MIMAT0028182
Sequence

42 - 

cuuugaguucuagcccgucuauc

 - 64

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22492913 "Novel microRNAs encoded by duck enteritis virus" Yao Y, Smith LP, Petherbridge L, Watson M, Nair V J Gen Virol. 93:1530-1536(2012).