Stem-loop sequence dev-mir-D11

AccessionMI0023590 (change log)
DescriptionDuck enteritis virus miR-D11 stem-loop
Stem-loop
       u     ua -ac  g      a     ac 
5' gaua agucu  g   cu uuuugc auucg  c
   |||| |||||  |   || |||||| |||||  g
3' uuau ucggg  c   gg aaaacg ugagu  c
       c     uc gac  g      c     aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence dev-miR-D11-3p

Accession MIMAT0028183
Sequence

44 - 

gcaaaagggcagccugggcucuau

 - 67

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22492913 "Novel microRNAs encoded by duck enteritis virus" Yao Y, Smith LP, Petherbridge L, Watson M, Nair V J Gen Virol. 93:1530-1536(2012).