Stem-loop sequence dev-mir-D16

AccessionMI0023595 (change log)
DescriptionDuck enteritis virus miR-D16 stem-loop
Stem-loop
       gu  ug       a     acacagug    g 
5' ccgg  uu  uccguug uguuu        ggcg a
   ||||  ||  ||||||| |||||        |||| u
3' ggcu  aa  aggcaac acaaa        ucgc a
       gc  gu       c     --------    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence dev-miR-D16-3p

Accession MIMAT0028189
Sequence

43 - 

cuaaacaccaacggaugaacgu

 - 64

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22492913 "Novel microRNAs encoded by duck enteritis virus" Yao Y, Smith LP, Petherbridge L, Watson M, Nair V J Gen Virol. 93:1530-1536(2012).