Stem-loop sequence dev-mir-D21

AccessionMI0023600 (change log)
DescriptionDuck enteritis virus miR-D21 stem-loop
Stem-loop
   -u  aug         ca  -  c      c   ac 
5'   gg   guuuggaga  gc ug gguggu uau  a
     ||   |||||||||  || || |||||| |||  u
3'   cc   caaaccucu  cg ac cuacca aua  c
   au  -aa         aa  u  -      -   au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence dev-miR-D21-5p

Accession MIMAT0028196
Sequence

5 - 

ugguuuggagacagcugcgguggu

 - 28

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dev-miR-D21-3p

Accession MIMAT0028197
Sequence

46 - 

auccaugcaaucuccaaacaacc

 - 68

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22492913 "Novel microRNAs encoded by duck enteritis virus" Yao Y, Smith LP, Petherbridge L, Watson M, Nair V J Gen Virol. 93:1530-1536(2012).