Stem-loop sequence dev-mir-D22

AccessionMI0023601 (change log)
DescriptionDuck enteritis virus miR-D22 stem-loop
Stem-loop
      a    c     ca  c         guau 
5' ucc guua ccgcc  ug gugacugcc    g
   ||| |||| |||||  || |||||||||    a
3' agg cgau ggcgg  ac cacuggcgg    a
      a    c     -a  a         aaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence dev-miR-D22-5p

Accession MIMAT0028198
Sequence

6 - 

uuacccgcccaugcgugacugcc

 - 28

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dev-miR-D22-3p

Accession MIMAT0028199
Sequence

44 - 

gucacacaaggcggcuagcagg

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22492913 "Novel microRNAs encoded by duck enteritis virus" Yao Y, Smith LP, Petherbridge L, Watson M, Nair V J Gen Virol. 93:1530-1536(2012).